Cloning and sequencing of the calcium-sensing receptor from the feline parathyroid gland

1. Introduction 

In 1993, Brown et al first cloned and expressed the bovine calcium-sensing receptor (CaSR) [1]. Since then, the CaSR gene has been sequenced for several species, including human and canine. The import role of the CaSR in regulating extracellular calcium concentration has been reported in several publications [2], [3], [4], [5], [6], [7]. Mutations in the human CaSR can result in its activation or deactivation [3]. An activating mutation leads to a new steady-state extracellular calcium concentration, which is lower than normal and is seen in people with a condition known as autosomal dominant hypoparathyroidism [4]. Activating mutations can also result in Bartter's syndrome because of functional interference of the CaSR with the NaKCl2 symporter and the ROMK channels at the thick ascending limb of Henley [3]. On the other hand, deactivating mutations result in a new steady-state extracellular calcium concentration that is higher than normal. These mutations have been associated with familial benign hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism in human beings [5].

Recently, the role of the CaSR in pathogenesis of several neoplastic conditions has been elucidated [8], [9], [10]. The CaSR is involved in the secretion of parathyroid hormone (PTH)–related peptide (PTHrP) leading to osteoblast up-regulation of receptor activator of NF-κB ligand (RANKL) that results in bone resorption mediated by activated osteoclasts, and it has been documented in people with metastatic neoplasia [8]. The CaSR acts as a relevant promoter of tumor growth in breast cancer metastasis to the bone by mediating up-regulation of estrogen receptors. In people with colon carcinoma, parathyroid adenoma, or parathyroid carcinoma, down-regulation of the receptor by the neoplastic cells assists in evading apoptosis; in contrast, in non-neoplastic cells, the CaSR participates in cell growth regulation [8]. The CaSR also has a role in an exaggerated growth hormone release in response to growth hormone–releasing hormone in people with pituitary tumors [9], [10].

Structurally, the CaSR has 3 main domains: an N-terminal extracellular domain where type 1 agonists such as divalent cation interact with the receptor; a transmembrane domain with 7 characteristic transmembrane helices; and a C-terminal intracellular domain with several phosphokinase A and C regulatory sites [2]. Following agonist activation of the CaSR in the parathyroid gland, a phospholipase C–mediated increase in inositol triphosphate results in an increased intracellular calcium concentration that inhibits PTH secretion [3]. It is the only known hormone secretion process to be inhibited by an increase in intracellular calcium concentration, rather than be stimulated by it [6]. The CaSR gene has 6 exons, and the sixth exon is significantly larger than the other exons [6].

Here we report cloning and sequencing the feline calcium-sensing receptor (fCaSR) mRNA. We have also developed exonic PCR primers for each fCaSR exon to enable fCaSR exonic PCR amplification from genomic DNA. Lastly, we report preliminary evaluation of the degree of genetic heterogeneity of the fCaSR mRNA sequence.

2. Materials and methods 

2.4. Genomic DNA extraction and fCaSR exonic PCR amplification 

Three mL of EDTA-anticoagulated blood were collected from 5 healthy domestic shorthair cats, and genomic DNA was extracted using the Flexigene DNA Kit (Qiagen) according to the manufacturer recommendations. All PCR reactions were run under the following conditions: 5μL of 10X PCR buffer, 2.5μL of 10mM dNTP mix, 0.2μL of 100μM respective forward primer, 0.2μL of 100μM respective reverse primer, 36.7μL of RNase free water, 0.4μL of 5 U/μL Long Range PCR Enzyme Mix, and 5μL of genomic DNA were added to a final reaction volume of 50μL. The PCR thermocycler program was set to have 3min of initial activation at 93°C, followed by 35 cycles of denaturation at 93°C for 15s, annealing at 63°C for 30s, and extension at 68°C for 1min. Refer to Table 1 for forward and reverse primer information of each fCaSR exon. Feline CaSR Exon 6 was amplified by 2 sets of overlapping primers because it was too large for a single sequencing reaction.

Table 1. Forward and reverse fCaSR exonic primer information.

	Name	Forward primer	Reverse primer
	Exon-1	AGGGAGTGAACTGCACCAAG	GCTTTTCTCCAACCACCAGA
	Exon-2	CCATGATTCAAACCCAGCTT	CGCATTGCCCCATATAAGAA
	Exon-3	GGTTCATCTGGCACCTCATT	GCCAAGCCTCAACCTTCTTG
	Exon-4	AGCCCTGTGGCTTGTACTCA	GTGGAGGCATCTGTGGTTCT
	Exon-5	CTCTTCCGTGCTTGTGTCAA	CAGGAGGGCATGTTCCTTTA
	Exon-6 part I	ACCTTCAGCATGCTCATCTTC	GTCTGAGGCGATTCCTCATC
	Exon-6 part II	TCTATGCCCCACAGTGACAA	GGATGAAGGAGATCCAGACG

3. Results 

The fCaSR (GenBank accession #GQ354887) is 3246bp long and has 1 forward open reading frame. The fCaSR has 6 exons (Table 2). Compared to the reported cDNA sequences of the human, canine, and bovine CaSRs (NCBI GeneID: 846, GeneID: 488007, GeneID: 281038, respectively), the fCaSR cDNA sequence has 91%, 93%, and 90% homology, respectively. At the amino acid level, the fCaSR has 96%, 96%, and 94% homology to the human, canine, and bovine CaSRs sequences, respectively.

Table 2. Summary of fCaSR exons.

	Exon no.	Location (base pair)	Size (base pair)
	Exon-1	1-186	186
	Exon-2	187-492	306
	Exon-3	493-1375	883
	Exon-4	1376-1627	252
	Exon-5	1628-1732	105
	Exon-6	1733-3246	1514

The deoxyribonucleotides at positions 987, 1065, 1269, and 3131 of the fCaSR represent probable sites of single nucleotide polymorphism (SNP). The first 3 are synonymous missense SNPs and do not change the amino acid code. The last SNP is a nonsynonymous missense mutation, which changes the amino acid code at position 1044 from arginine to proline. Table 3 summarizes the SNPs found in the 6 cats included in this report.

Table 3. Summary of SNPs found in the 6 cats included in this report.

	Nucleotide position	Position 987	Position 1065	Position 1269	Position 3131 (R1044P)
	Cat 1	C/T	C/A	A	G/C
	Cat 2	C/T	C/A	G/A	G
	Cat 3	T	C	G	C
	Cat 4	T	C	G	G
	Cat 5	C/T	C/A	G/A	G
	Cat 6	C/T	C/A	G/A	G

4. Discussion 

This is the first report of cloning and sequencing of the putative fCaSR. This cDNA sequence may serve as a springboard for further genetic characterization of the fCaSR. As with the human CaSR, potential desensitizing or sensitizing mutations in the fCaSR may account for disturbances in extracellular calcium regulation in cats [3].

Primary hyperparathyroidism is very rare in cats, and only 19 reports have been published so far [11]. The majority of published cases involve benign, or less commonly, malignant neoplastic transformation of cells of the parathyroid gland. The CaSR plays a role in cell differentiation and has been noted to be down-regulated in people with parathyroid adenoma or carcinoma [8]. It may be of interest to investigate whether an acquired mutation in the fCaSR is playing any role in neoplastic transformation of the parathyroid gland in cats with parathyroid gland adenoma or carcinoma. A somewhat similar attempt was previously described in Keeshonden dogs with primary hyperparathyroidism, in which there is an autosomal dominant mode of inheritance, but that investigation did not indicate any germline mutations involving the canine CaSR [12].

There are 2 reported cases of cats diagnosed with primary hyperparathyroidism that had histopathologic evidence of hyperplasia of all 4 parathyroid glands [13]. These cats may represent rare feline cases of germline mutations in the fCaSR similar to people with familial hypocalciuric hypercalcemia. Alternatively, secondary hyperplasia resulting from chronic stimulation of the parathyroid gland by fCaSR autoantibodies may be considered. Autoimmunity involving the parathyroid gland has been reported in people [14]. The fCaSR nucleotide sequence reported here may allow for fCaSR expression in cell lines and future identification of autoantibodies against the fCaSR.

Feline primary hypoparathyroidism is even more rare than primary hyperparathyroidism, and approximately 14 cases have been reported so far [15]. In some cases of people with previously diagnosed primary hypoparathyroidism, the diagnosis had been revised when molecular tools were applied and indicated an activating mutation of the CaSR [5]. Some of the reports of feline primary hypoparathyroidism involve a kitten and young adult cats, raising the question of whether an activating fCaSR mutation was behind the hypocalcemia in these cases [16], [17].

Last, the significance of the nonsynonymous missense SNP is not known [3]. It is likely that other SNPs will be found in the fCaSR sequence once more individual feline sequences have been obtained for analysis. In addition, it is also possible that differences in the fCaSR sequence will exist between different cat breeds, similar to different SNPs that are seen among different human ethnicities [6]. It is important to document those differences because they may be associated with predisposition to the development of certain metabolic abnormalities, as observed in people [6].