Characterization of the receptors for chicken GHRH and GHRH-related peptides: Identification of a novel receptor for GHRH and the receptor for GHRH-LP (PRP)

2.1. Chemicals and hormones 

All chemicals were obtained from Sigma-Aldrich (St. Louis, MO, USA), and restriction enzymes were obtained from Amersham Biosciences (GE Healthcare Bio-Sciences Corp., Piscataway, NJ, USA), unless stated otherwise. Ovine PACAP38 (oPACAP38) was purchased from Bachem (Bachem, Inc., Torrance, CA, USA). Chicken vasoactive intestinal polypeptide (cVIP) and turkey PHI (tPHI) were gifts from Professor M.E. El-Halawani (Department of Animal Science, University of Minnesota, St. Paul, MN). Chicken GHRH1-47 (cGHRH1-47) and GHRH-like peptide (cGHRH-LP1-46) were synthesized using solid-phase Fmoc chemistry (GL Biochem, Shanghai, China). The purity of the synthesized chicken peptides was greater than 95% (analyzed by HPLC), and their structure was verified by mass spectrometry (GL Biochem). Chicken GHRH1-47, GHRH-LP1-46, VIP, and ovine PACAP38 were first dissolved in distilled water and turkey PHI in 0.1N NaOH and then diluted to the desired concentrations with medium before use.

2.2. Total RNA extraction 

Adult chickens were killed, and different tissues including the heart, small intestine, kidney, liver, lung, muscle, ovary, pancreas, pituitary, spleen, and testis, and different brain regions including the telencephalon, cerebellum, hindbrain, midbrain, and hypothalamus were collected for total RNA extraction. Total RNA was extracted from chicken tissues with Tri-reagent (Molecular Research Center, Cincinnati, OH, USA) according to the manufacturer's instructions and dissolved in diethylpyrocarbonate (DEPC)-treated water. All experiments were performed under license from the Government of the Hong Kong Special Administrative Region and endorsed by the Animal Experimentation Ethics Committee of The University of Hong Kong.

2.3. Cloning the full-length cDNAs of chicken GHRHR2, GHRH-LPR (PRP-R), VPAC1, VPAC2, PAC1, and GHRHR1 

Based on the predicted partial cDNA sequences of GHRHR2 and GHRH-LPR (accession no.: XM_425958), 2 gene-specific primers were designed for 5′- rapid amplification of cDNA ends (RACE) to amplify the 5′ cDNA ends of each receptor from adult chicken brain using the SMART-RACE cDNA Amplification Kit (Clontech, Palo Alto, CA, USA). The amplified PCR products were cloned into pBluescript SK(+/-) vector (Stratagene, La Jolla, CA, USA) through T/A cloning and sequenced using a Genetic Analyzer ABI3100 (PerkinElmer, Foster City, CA, USA). According to the partial cDNA sequence, new gene-specific primers near the 5′-cDNA ends were designed to amplify the full-length cDNA of each receptor from brain tissue using 3′-RACE. The PCR products were then cloned into pBluescript SK(+/-) vector and sequenced. The full-length cDNA of each receptor was finally determined by sequencing (PerkinElmer) at least 3 independent clones.

According to the predicted sequence of chicken VPAC2 (XM_418556) or the published sequences of the chicken VPAC1, GHRHR1, and PAC1 genes [27], [28], [31], gene-specific primers were designed to amplify the full-length cDNA from adult chicken brain or pituitary. The amplified PCR products were cloned into the pBluescript SK(+/-) vector and then sequenced by the ABI3100 Genetic Analyzer (PerkinElmer).

2.4. Reverse transcription and polymerase chain reaction 

Reverse transcription (RT) was performed at 42°C for 2h in a total volume of 10μL consisting of 2μg total RNA from different tissues, 1× single-strand buffer, 0.5mM each deoxynucleotide triphosphate, 0.5μg oligo-deoxythymide, and 100 U MMLV reverse transcriptase (Promega, Madison, WI, USA). All negative controls were carried out under the same condition without reverse transcriptase added in the 10μL of reaction mix.

Polymerase chain reaction (PCR) was carried out in a total volume of 20μL consisting of 1× PCR buffer, 0.2mM each deoxynucleotide triphosphate, 2.0mM MgCl2, 0.2μM each primer, and 0.5 U of Taq DNA polymerase (Invitrogen, Calsbad, CA, USA) on the PTC-225 Peltier Thermal Cycler (MJ Research Inc, Waltham, MA, USA). Reverse transcription polymerase chain reaction (RT-PCR) assays were performed to examine the relative mRNA concentrations of cGHRHR1, cGHRHR2, cGHRH-LPR (cPRP-R), cPAC1, cVPAC1, and cVPAC2 in adult chicken tissues according to our previously established methods [3], [34]. For the β-actin gene, 23 cycles of 30s at 95°C, 30s at 58°C, and 60s at 72°C were used, followed by 5min of extension at 72°C. For the cGHRHR1, cGHRHR2, cGHRH-LPR (PRP-R), cVPAC1, cVPAC2, and cPAC1 genes, different (28, 29, or 35) cycles of 30s at 95°C, 30s at 58°C, and 60s at 72°C were used, followed by 5min of extension at 72°C. The primers used are listed in Table 1. The PCR products were visualized on a UV-transilluminator (Bio-Rad Laboratories, Inc. Hercules, CA, USA) after electrophoresis on 2% agarose gel containing ethidium bromide. To confirm the specificity of the PCR reaction, the identity of each PCR product was verified by sequencing.

Table 1. Primers useda.

	Gene/construct	Sense/antisense	Primer sequence (5′-3′)	Size (bp)
	Primers for constructing the expression plasmidsb
	cGHRHR1	Sense	GGATCCTAGCATGTCATACCA	1280
		Antisense	TCTAGAGTCTTTAGCACACAGA
	cGHRHR2	Sense	GGTACCATGGGGTGCCCATGGCT	1415/1532
		Antisense	GAATTCTCCTCCCTCAGGTTGGCT
	cGHRH-LPR	Sense	GGTACCATGCTGCGGAGGATGCGA	1369
		Antisense	CTCGAGCAACTCGGCCTGCTAGA
	cVPAC1	Sense	GGTACCATGCAATCCGCTCGGCT	1364/1256
		Antisense	TCTAGAACCTCTCTCCATCACACCA
	cVPAC2	Sense	GGTACCGGCACTCGGCTGGCAT	1348
		Antisense	CTCGAGATTTATATCATGGTGGTC
	cPAC1	Sense	GGGTACCGCCGCCACCATGGCCATCTGTTGGAAG	1438
		Antisense	GGAATTCTATGTCGCTAGATTCTCCG
	Primers for RT-PCR assay
	ghrhr1	Sense	GACATTGACCATTGCAGCTT	407
		Antisense	CGTCTGTACTGAGATGAGTTATTGA
	ghrhr2	Sense	CATGAGACTGACCAAGTCCA	522/405
		Antisense	GAATTCTCCTCCCTCAGGTTGGCT
	ghrh-lpr	Sense	GGTACCATGCTGCGGAGGATGCGA	336/406
		Antisense	TCCACAGGCAACAGCATATG
	vpac1	Sense	CAGAGTGCAGCATCATGCT	374/266
		Antisense	CATAGCAGCTGTGAGAGCA
	vpac2	Sense	CCTGTTCCTCTCCTTCATTCTA	325
		Antisense	CCAGCAACCAGTGTCCTCTA
	pac1	Sense	ACTGAAGATGGCTGGTCTGA	376
		Antisense	GCCAGAAGTAGTTGGACATG
	β-Actin	Sense	CAATGGCTCCGGTATGTGCA	401
		Antisense	AGGCATACAGGGACAGCACA

a All primers were synthesized by Invitrogen (Hong Kong). b The restriction enzyme recognition sites added are underlined.

2.5. Functional characterization of chicken GHRHR1, GHRHR2, GHRHR2-v1, VPAC1, VPAC1-v1, VPAC2, GHRH-LPR, and PAC1 in cultured Chinese hamster ovary cells 

According to the full-length cDNAs of cGHRHR1, cGHRHR2, cGHRHR2-v1, cVPAC1, cVPAC1-v1, cVPAC2, cGHRH-LPR, and cPAC1, gene-specific primers flanking the start and stop codons (with restriction enzyme recognition site added at the 5′ end) were used to amplify the open reading frame of each receptor from adult chicken brain or pituitary using high-fidelity Taq DNA polymerase (Roche diagnostics, Basel, Switzerland) (Table 1). The amplified PCR products were cloned into pBluescript II SK (+/-) (Stratagene) vector and sequenced. The insert with correct sequence was released from pBluescript II SK (+/-) (Stratagene) and then subcloned into the pcDNA3.1 (+) expression vector (Invitrogen).

To test the functionality of chicken GHRHR1, GHRHR2, GHRHR2-v1, VPAC1, VPAC1-v1, VPAC2, GHRH-LPR, and PAC1, the pGL3-CRE-luciferase reporter construct was used in this study [3]. The pGL3-CRE-luciferase reporter plasmid was constructed by inserting a promoter containing multiple cAMP-response elements (CRE) into the promoterless pGL3-Basic vector (Promega Corp., Madison, WI, USA) [3]. The Chinese hamster ovary (CHO) cells were cultured in Dulbecco's minimum essential medium supplemented with 10% (vol/vol) fetal bovine serum (HyClone Logan, UT, USA), 100 U/mL penicillin G, and 100 ug/mL streptomycin (Life Technologies, Inc., Grand Island, NY, USA) in a 90-cm culture dish (NUNC, Rochester, NY, USA) and incubated at 37°C with 5% CO2. Cells were then plated in a 96-well plate at a density of 3×105 cells per well 1 d before transfection. A mixture containing 700ng of pGL3-CRE-luciferase reporter construct, 200ng of pcDNA3.1 expression plasmid (or empty vector), and 6μL of Lipofectamine (Invitrogen) was prepared in 50μL of PBS solution. Transfection was performed according to the manufacturer's instructions when cells reached 70% confluency. After 24h of culture, CHO cells were trypsinized and cultured in a 96-well plate at a density of 2×104 cells per well at 37°C for 24h before peptide treatment. After removal of the medium from the plate, 100μL of hormone-containing medium (or hormone-free medium) was added. The cells were incubated for an additional 6h at 37°C before being harvested for luciferase assay. After removal of culture medium, CHO cells were lysed by adding 50μL of 1×Passive Lysis Buffer (Promega) per well, and the luciferase activity of 15μL of cellular lysates was determined using luciferase assay reagent (Promega).

2.6. Data analysis 

The luciferase activities in each treatment group were expressed as relative fold increase as compared with the control group (without hormone treatment). The data were analyzed by 1-way analysis of variance followed by Dunnett's test using GraphPad Prism 4 (GraphPad Software, San Diego, CA, USA). To validate our results, all experiments were repeated 2 to 5 times.

3.1. Identification of a novel GHRH receptor (GHRHR2) gene in chickens 

Based on the predicted partial sequence of a novel receptor sharing 46% amino acid sequence identity to chicken GHRHR, gene-specific primers were designed to amplify the full-length cDNA of this receptor from adult chicken brain using the RACE method. The cloned full-length cDNA is 1945bp in length (GenBank accession no.: EF209054) and encodes a receptor precursor of 423 amino acids, which shares 46% amino acid sequence identity to GHRHR of the chicken (accession No.: DQ230840) and human (accession no.: NM_000823) (Fig. 1A), 53% identity to goldfish GHRH-LP (PRP) receptor (accession no.: AF048819), and about 50% identity to VIP type I receptor (VPAC1) of the chicken (accession no.: EF514901), rat (accession no.: NM_012685), and human (accession no.: NM_004624). Like other members in the GPCR B-I subfamily [20], this novel receptor has a large N-terminal extracellular domain characterized by the presence of 6 conserved cysteines and 2 N-linked glycosylation sites (Asn-X-Thr/Ser, where X represents any amino acid except proline), 7 transmembrane domains (TMD), and an intracellular carboxyl terminus. Moreover, the other characteristic residues and motifs known to be shared by GPCR B-I subfamily members, such as an aspartate at position 68 for high-affinity ligand binding at the large N-terminal extracellular domain and “RLTK” motif in the third intracellular loop for G protein coupling [2], [20], [35], were noted in this novel receptor (Fig. 1A), clearly indicating that it should be classified as a new member in this subfamily. According to its pharmacological profile examined in the following section, this receptor is designated as the GHRH type II receptor (cGHRHR2) in this study, whereas the other GHRH receptor identified in previous studies is defined as the GHRH type I receptor (cGHRHR1) [28], [29], [30].

View Large Image Download to PowerPoint

Fig. 1. (A) Alignment of amino acid sequences of chicken GHRHR2 (cGHRHR2: EF209054) with that of zebrafish GHRHR2 (zGHRHR2: EU056169), Xenopus GHRHR2 (xGHRHR2) and chicken GHRHR1 (cGHRHR1: DQ230840). Partial amino acid sequence of xGHRHR2 was predicted based on the expressed sequence tag sequence (CN082884) and genomic sequence on scaffold_165 of Xenopus tropicalis. (B) Amino acid sequence alignment of chicken GHRH-LPR (cGHRH-LPR or cPRP-R: EF209053) with goldfish (gGHRH-LPR: AF048819) and fugu (fGHRH-LPR: AJ296145) GHRH-LPR. The seven transmembrane domains (TMD) are shaded and labeled accordingly; the conserved 6 cysteine residues critical for disulfide bond formation are boxed; the conserved aspartate (D) is bold and underlined; the putative N-linked glycosylation sites (NXT/S, where X represents any amino acid residue except proline) are shaded; the “RLAK” or “RLTK” (or RLSR in cGHRHR1) motif for G protein coupling in the third intracellular loop is bold and boxed; and dots indicate amino acids identical to cGHRHR2 in (A) or cGHRH-LPR in (B), and dashes represent gaps in the sequence.

Using RT-PCR, a full-length cDNA encoding a novel cGHRHR2 variant (462 a.a.) was also cloned from chicken brain tissue. Comparison of this novel cGHRHR2 variant to the chicken genome database revealed that it arises from the retention of intron 12 (117bp) and thus results in an insertion of 39 amino acids at the short C-terminal tail (accession no.: EF581858) (Fig. 2). This receptor variant is accordingly designated as cGHRHR2-v1.

View Large Image Download to PowerPoint

Fig. 2. (A) Genomic organization of the chicken GHRH-LPR (PRP-R) gene. Fourteen exons are labeled accordingly. The presence of an extra exon (exon 2, 67bp) results in the formation of GHRH-LPR transcript variant (cGHRH-LPR-v1) encoding either a short peptide of 34 a.a. (B) or a protein of 279 a.a (using an alternative ATG on exon 7) identical to the C-terminal portion of GHRH-LPR (accession no. EF581857). The gel photo in (A) indicates the amplified full-length cDNAs of GHRH-LPR (wt) and GHRH-LPR-v1 (v1) from adult chicken brain (33 cycles). +, RT with reverse transcriptase; -, RT without reverse transcriptase. (B) shows the partial cDNA and deduced amino acid sequence of GHRH-LPR-v1. The insertion of exon 2 (67bp, shaded) in the GHRH-LPR results in an introduction of a premature stop codon (*) on exon 2. (C) Structural features of chicken GHRHR2 splice variant 1 (GHRHR2-v1) (accession no.: EF581858). Retention of intron 12 (117bp) results in an insertion of 39 amino acids at the C-terminal tail near the transmembrane domain 7. (D) Structural features of chicken VPAC1 splice variant 1 (VPAC1-v1) (accession no.: EF514902). Excision of exon 3 (108bp) causes a deletion of 36 amino acids at the large N-terminal extracellular domain of cVPAC1.

3.2. Identification of the GHRHR2 gene in zebrafish and Xenopus genomes 

The low amino acid sequence identity (46%) between cGHRHR1 and cGHRHR2 led us to speculate that cGHRHR2 originated much earlier in the history of vertebrate evolution. To test this hypothesis, using cGHRHR2 as a reference, we performed a search in the genome databases (http://www.ensembl.org) of different classes of vertebrate species including the human, rat, mouse, Xenopus (Xenopus tropicalis), and zebrafish. Interestingly, the GHRHR2 gene was found in both the Xenopus (Scaffold_165) and the zebrafish genomes (chromosome 12) (Fig. 1A). According to the genomic sequences of zebrafish and Xenopus (or Xenopus EST: CN082884), we cloned a full-length cDNA of a zebrafish GHRHR2 from the brain (accession no.: EU056169) and predicted the partial amino acid sequence of Xenopus GHRHR2 (289 amino acids) (Fig. 1A). These findings also confirm the presence and expression of the GHRHR2 gene in nonmammalian vertebrates, but in contrast, the GHRHR2 gene could not be found in genomes of the mouse, rat, or human.

3.3. Cloning of the full-length cDNA of chicken GHRH-LPR (PRP-R) 

Based on the predicted partial sequence of chicken GHRH-LP (PRP) receptor (accession no.: XM_425958), a full-length cDNA of GHRH-LPR (PRP-R) was isolated from adult chicken brain using the RACE approach. The cloned GHRH-LPR cDNA is 3335bp in length and encodes a precursor protein of 444 amino acids (EF209053) (Fig. 1B). The putative GHRH-LPR shares 57% amino acid sequence identity with GHRH-LPR of the goldfish (AF048819) and fugu (AJ296145) (Fig. 1B), and 48% identity with VPAC1 of the chicken (EF514901), frog (AF100644), and mouse (NM_011703). Alignment of chicken GHRH-LPR with fish GHRH-LPR indicated that the highest amino acid sequence identity was noted in the 7 transmembrane domains (TMD), whereas the other regions, particularly the N-terminal extracellular domain and the long intracellular carboxyl terminus, are less conserved (Fig. 1B). However, like other members in the GPCR B-I subfamily [20], the characteristic residues, such as 6 cysteines and an aspartate at position 56 in the large N-terminal extracellular domain and the “RLAK” motif in the third intracellular loop, are fully conserved across species (Fig. 1B). In addition, 2 N-linked glycosylation sites (Asn-X-Thr/Ser, where X represents any amino acid except proline) were noted in the large N-terminal extracellular domain.

In addition to the cloned full-length cDNA of GHRH-LPR, a full-length cDNA of 1423bp encoding a novel GHRH-LPR variant (accession No.: EF581857) was also isolated in this study. Comparison to the chicken genome database indicated that this novel cDNA resulted from an insertion of a new exon (exon 2, 67bp) between exons 1 and 3 and thus consisted of 14 exons in total (Fig. 2). This cDNA may encode either a putative short peptide of 34 amino acids including the signal peptide (Fig. 2B), or a protein of 279 amino acids identical to the C-terminal portion of full-length GHRH-LPR, which is supposed to use the downstream ATG located at exon 7 as a translation start site. This putative receptor variant (34 a.a. or 279 a.a.) is defined as cGHRH-LPR-v1 in this study (Fig. 2).

3.4. Cloning of the full-length cDNA of chicken VPAC2 

According to the predicted sequence of chicken VPAC2 (accession no.: XM_418556), we cloned the full-length cDNA of VPAC2 from chicken brain using RT-PCR. The cloned full-length cDNA is 1687bp in length and encodes a precursor protein of 439 amino acids (accession no.: AY953142). The putative chicken VPAC2 shares high amino acid sequence identity with that of the human (74%) (NM_003382), rat (73%) (NM_017238), Xenopus (66%) (NM_001127144), and zebrafish (62%) (EU069395, also renamed as the PHI receptor) [22], [36], with the highest identity noted in the 7 transmembrane domains (TMD) (Fig. 3). The characteristic residues shared by GPCR B-I subfamily members [2], [20], such as 6 cysteines and an aspartate at position 69 at the large N-terminal extracellular domain, as well as the “RLAK” motif in the third intracellular loop, are highly conserved across species (Fig. 3). In addition, three N-linked glycosylation sites (Asn-X-Thr/Ser, where X represents any amino acid except proline) and a “PDV/PDI” motif in the third intracellular loop typical of VIP-binding receptors were also found in chicken VPAC2 (Fig. 3).

View Large Image Download to PowerPoint

Fig. 3. Amino acid sequence alignment of chicken VPAC2 (cVPAC2: AY953142) with human VPAC2 (hVPAC2: NM_003382), rat VAPC2 (rVPAC2: NM_017238), and zebrafish VPAC2 (EU069395; also renamed as PHI receptor [zPHI-R] [22]). The 7 transmembrane domains (TMD) are shaded and labeled accordingly; the 6 conserved cysteine residues for disulfide bond formations are boxed; the “RLAK” motif for G protein coupling in the third intracellular loop is bold and boxed; the conserved aspartate (D) is bold and underlined; the putative N-linked glycosylation sites (NXT/S, where X represents any amino acid residue except proline) are shaded; the signature “PDV/PDI” motif (boxed and shaded) of VIP receptors is also found in chicken VPAC2; dots indicate amino acids identical to cVPAC2, and dashes represent gaps in the sequence.

3.5. Isolation of a novel splice variant of chicken VPAC1 (cVPAC1-v1) 

To study the functionality of chicken VPAC1, a full-length cDNA of chicken VPAC1 (accession no.: EF514901) was cloned from chicken brain tissue using RT-PCR. It encodes a precursor protein of 446 amino acids, as reported by Kansaku et al. [31]. Interestingly, a cDNA encoding a novel VPAC1 variant of 410 amino acids was also cloned in this study (accession no.: EF514902). Sequence analysis revealed that this receptor variant resulted from an excision of exon 3 (108bp), which causes a deletion of 36 amino acids at the large N-terminal extracellular domain (Fig. 2). In this study, this receptor variant is designated as VPAC1 variant 1 (cVPAC1-v1).

3.6. Cloning the full-length cDNAs of chicken PAC1 

To further characterize the pharmacological property of cPAC1, the open reading frame of cPAC1 was cloned from chicken brain. Interestingly, more than 14 splice variants of cPAC1 were identified from the brain (or ovary) in our preliminary study [37]. Because of the multiplicity and complexity of cPAC1 variants, the pharmacological profile was examined only for the short form of cPAC1 (471 amino acids, accession no.: EF568107) in this study. The signaling property and expression patterns of the other cPAC1 splice variants will be reported in another forthcoming article.

3.7. Functional characterization of cGHRHR1, cGHRHR2, cGHRH-LPR, cVPAC1, cVPAC2, and cPAC1 

Six receptors (cGHRHR1, cGHRHR2, cGHRH-LPR, cVPAC2, cVPAC1, and cPAC1) homologous to vertebrate GHRHR/VPAC1 were identified from the chicken genome. The high degree of amino acid sequence identity (45%-53%) between these receptors led us to speculate that they may function as the receptors for GHRH and GHRH-related peptides, including GHRH-LP, PHI, VIP, and PACAP. To test this hypothesis, each receptor was transiently expressed in CHO cells and subjected to treatment with GHRH and GHRH-related peptides, and the receptor activation was then monitored by a previously published pGL3-CRE-luciferase reporter system [3].

3.7.1. Experiment 1: Functional characterization of cGHRHR1 and cGHRHR2 

As shown in Fig. 4A, chicken GHRH could increase luciferase activity of CHO cells via activation of cGHRHR1 with an EC50 of 0.053nM [3] (Fig. 4A). In addition to GHRH, other GHRH-related peptides, including oPACAP, cGHRH-LP, tPHI, and cVIP, could also activate cGHRHR1 and stimulate luciferase activity of CHO cells in dose-dependent ways. However, their potencies (PACAP, EC50: 5.606nM; GHRH-LP, EC50: 12.966nM; cVIP, EC50: 11.534nM; tPHI, EC50: 15.028nM) were 100- to 300-fold lower than that of cGHRH (Fig. 4A). These findings coincide well with previous reports [3], [29], [33].

View Large Image Download to PowerPoint

Fig. 4. Activation of chicken GHRHR1 (A), GHRHR2 (B), GHRH-LPR (C), PAC1 (D), VPAC1 (E), and VPAC2 (F) upon peptide (cGHRH, cGHRH-LP, tPHI, oPACAP, and cVIP: 10−12-10−6M, 6h) treatment, monitored by a system of co-transfection of pGL3-CRE-luciferase reporter construct and receptor expression plasmid in cultured CHO cells. Co-transfection of the empty pcDNA3.1 vector and pGL3-CRE-luciferase reporter construct was used as an internal control, and peptide treatment did not increase the luciferase activity of CHO cells at any concentration tested (data not shown). Each data point represents mean±SEM of 3 replicas.

Like cGHRHR1, cGHRHR2 could also be activated by all the peptides tested (Fig. 4B). The order of potency was cGHRH (EC50: 0.125nM)>tPHI (EC50: 12.051nM)>oPACAP(EC50: 24.135nM)>cVIP (EC50: 40.935nM)>cGHRH-LP (EC50: 51.980nM). Since GHRH was at least 100-fold more potent than other GHRH-related peptides in activating the 2 GHRH receptors, it is strongly suggested that cGHRHR1 and cGHRHR2 can function as highly specific receptors for cGHRH (Fig. 4) [3], [29], [33].

Similar to chicken GHRH, human pancreatic GHRH1-40 (hpGHRH1-40) was capable of potently activating the 2 GHRH receptors. However, hpGHRH1-40 appeared to be 5-fold more potent in activating cGHRHR1 than cGHRHR2 (unpublished data).

3.7.4. Experiment 4: Confirmation of coupling of the six receptors to the intracellular protein kinase A (PKA) signaling pathway 

Activation of the 6 receptors by GHRH and GHRH-related peptides could significantly increase the intracellular luciferase activity of CHO cells (Fig. 4), suggesting that these receptors, like other members in the GPCR B-I subfamily, are functionally coupled to the intracellular cAMP-dependent protein kinase A (PKA) signaling pathway. To test this hypothesis, a specific PKA inhibitor H89 was used, and as expected, H89 (10μM) was able to either significantly or completely abolish the stimulatory effect of each peptide on receptor activation (Fig. 5), indicating that all 6 receptors are coupled to the intracellular PKA signaling pathway.

View Large Image Download to PowerPoint

Fig. 5. Activation of 6 receptors by GHRH (A and B: GHRH, 1nM) or GHRH-related peptides (C: GHRH-LP, 100nM; D: PACAP, 1nM; E and F: VIP, 1nM) in the absence or presence of H89 (10μM), monitored by a system of co-transfection of pGL3-CRE-luciferase reporter construct and receptor expression plasmid in cultured CHO cells. H89 was added 1h before peptide treatment. In each graph, “T” represents peptide treatment and “C” represents control without peptide treatment. Each data point represents mean±SEM of 3 replicas. *, P<0.01 vs control (in the absence of H89); #, P<0.01 vs. peptide treatment (in the presence of H89).

3.8. Functional characterization of chicken GHRHR2-v1 and VPAC1-v1 

To examine the functionality of the novel chicken GHRHR2 variant 1 (cGHRHR2-v1) and VPAC1 variant 1 (cVPAC1-v1), the receptor variants were also transiently expressed in CHO cells and treated with cGHRH1-47 or cVIP accordingly. As shown in Fig. 6, chicken GHRH could stimulate luciferase activity in CHO cells in a dose-dependent manner via activation of cGHRHR2-v1 (EC50: 3.099nM), suggesting that cGHRHR2-v1 is still coupled to the intracellular PKA signaling pathway. However, cGHRH is 25-fold less potent than cGHRHR2 in activating cGHRHR2-v1, suggesting that the insertion of 39 amino acids at the conserved region in the C-terminus may affect the efficacy of G protein coupling [38].

View Large Image Download to PowerPoint

Fig. 6. Functional characterization of chicken GHRHR2-variant 1 (GHRHR2-v1) and VPAC1 variant 1 (VPAC1-v1). (A) Activation of chicken GHRHR2-v1 by cGHRH (cGHRH:10−12-10−6M, 6h) monitored by a system of co-transfection of pGL3-CRE-luciferase reporter construct and chicken receptor expression plasmid in cultured CHO cells. (B) Chicken VIP (10−12-10−6M, 6h) failed to increase luciferase activities of cultured CHO cells expressing cVPAC1-v1. Each data point in (A) and (B) represents mean±SEM of 3 replicas.

In contrast, chicken VIP failed to activate cVPAC1-v1 at any concentration tested (10−12-10−6M) (Fig. 6). Since cVPAC1-v1 lacks 36 amino acids, including the conserved aspartate at position 59, which was demonstrated to be critical for high-affinity ligand binding in human VPAC1 [39], the inability of cVPAC1-v1 to transduce signal is likely owing to the reduced affinity for VIP, as we proposed for chicken cGHRHR1-v1, which also has a deletion of 36 amino acids (exon 3) at the same location [33].

3.9. Expressions of chicken GHRHR1, GHRHR2, GHRH-LPR, VPAC1, VPAC2, and PAC1 in adult chicken tissues 

Using an RT-PCR assay, we further examined the expressions of 6 receptors in adult chicken tissues.

As shown in Fig. 7, Fig. 8, using a high PCR cycle (35 cycles), cGHRHR1 was detected to be predominantly expressed in the pituitary and weakly expressed in the testis, pancreas, muscle, and several brain regions including the telencephalon, midbrain, hindbrain, and hypothalamus. Using a low PCR cycle (26 cycles), strong PCR signal was detected only in the pituitary, confirming the predominant expression of cGHRHR1 in the pituitary, as reported previously [28], [29], [30].

View Large Image Download to PowerPoint

Fig. 7. (A) Detection of cGHRHR1, cGHRHR2 and cGHRH-LPR (PRP-R) mRNA in the pituitary (Pi) and various brain regions, including the telencephalon (Te), cerebellum (Cb), midbrain (Mb), hindbrain (Hb), and hypothalamus (Hp) of adult chickens using RT-PCR. The number in brackets indicates the PCR cycle used. Arrows indicated the splice variant (GHRHR2-v1 or GHRH-LPR-v1) of chicken GHRHR2 or GHRH-LPR. (B) Detection of cVPAC1, cVPAC2 and cPAC1 mRNA in the pituitary (Pi) and various brain regions, including the telencephalon (Te), cerebellum (Cb), midbrain (Mb), hindbrain (Hb), and hypothalamus (Hp) of adult chickens using RT-PCR. Arrows indicate the splice variant (cVPAC1-v1) of cVPAC1. Numbers in brackets indicate the PCR cycle number used.

View Large Image Download to PowerPoint

Fig. 8. (A) Detection of cGHRHR1, cGHRHR2, and cGHRH-LPR (PRP-R) mRNA in adult chicken tissues, including the heart (He), small intestine (In), kidney (Ki), liver (Li), lung (Lu), muscle (Mu), ovary (Ov), spleen (Sp), testis (Te), pituitary (Pi), and pancreas (Pa), using RT-PCR. Arrows indicated the splice variant (GHRHR2-v1 or GHRH-LPR-v1) of chicken GHRHR2 or GHRH-LPR. (B) RT-PCR detection of the mRNA expression of cVPAC1, cVPAC2, and cPAC1 in adult chicken tissues, including the heart (He), small intestine (In), kidney (Ki), liver (Li), lung (Lu), muscle (Mu), ovary (Ov), spleen (Sp), testis (Te), pituitary (Pi), and pancreas (Pa). The number in brackets indicates the PCR cycle used.

Using a high PCR cycle (35 cycles), the expression of cGHRHR2 could be detected in several tissues including the pituitary, testis, liver, muscle, spleen, and various brain regions. However, when a lower PCR cycle (29 cycles) was used, a strong PCR signal of cGHRHR2 could be detected only in the pituitary and all brain regions examined except the cerebellum, suggesting a relatively higher expression level of cGHRHR2 in these tissues (Fig. 7, Fig. 8). Although a weak PCR signal of cGHRHR2-v1 could be detected in these tissues, the expression level of cGHRHR2-v1 seemed to be much lower than that of cGHRHR2 (Fig. 7, Fig. 8).

Using RT-PCR, the mRNA expression of cGHRH-LPR (cPRP-R) was detected in the pituitary, ovary, testis, small intestine, and various brain regions. A high expression level of cGHRH-LPR was consistently noted in the telencephalon, midbrain, hindbrain, and hypothalamus of different individuals, whereas a low level of expression was observed in the cerebellum, pituitary, ovary, testis, and small intestine (Fig. 7, Fig. 8). Interestingly, cGHRH-LPR-v1 mRNA could also be detected in the pituitary and brain regions, however, the PCR signal of cGHRH-LPR-v1 was much weaker than that of cGHRH-LPR (Fig. 7, Fig. 8).

In contrast to the restricted tissue distribution of cGHRHR1, cGHRHR2, and cGHRH-LPR in chickens, cVPAC1, cVPAC2 and cPAC1 were detected to be widely expressed in most of the tissues examined (Fig. 7, Fig. 8). The wide distribution of cPAC1 and cVPAC1 coincided with earlier reports in chickens [27], [31]. In spite of their overlapping tissue distribution, apparent differential expression of the 3 receptors was noted in the pituitary. A high expression level of cVPAC1 was detected in the pituitary, whereas a weak expression of cPAC1 and almost undiscernible expression of cVPAC2 were noted (Fig. 7). In addition, differential expression of cVPAC1 and cVPAC2 was noticed in the central nervous system (CNS). For instance, a high expression level of cVPAC2 was observed in the hypothalamus and hindbrain, whereas cVPAC1 was weakly expressed in these regions (Fig. 7).

A faint band of cVPAC1-v1 was noted in various brain regions. However, its expression level seemed to be much lower than that of cVPAC1 (Fig. 7).

4.1. Two GHRH receptors in chickens 

There is a large body of evidence showing that mammalian GHRH could potently stimulate chicken pituitary growth hormone secretion both in vivo and in vitro, indicating that, as in mammals, hypothalamic GHRH is a major growth hormone–releasing factor (GRF) in chickens [1], [13], [14], [40]. Previously, GHRH-LP has long been viewed as the putative GRF in chickens. However, its weak potency on pituitary GH secretion questioned its identity as the true physiological GRF [12]. Recently, we identified the authentic chicken GHRH gene and demonstrated that it is expressed predominantly in the hypothalamus [3]. This finding, together with the demonstration of the nearly exclusive expression of GHRHR in the pituitary (Fig. 7) [28], [29], [30], supports the concept of hypothalamic GHRH in the neuroendocrine regulation of pituitary function in birds [3], [13], [14], [40].

Strikingly, in addition to the previously identified GHRHR (designated as cGHRHR1 in this study) [28], [29], [30], a second GHRH receptor gene GHRHR2 was identified in this study. This novel GHRH receptor shares only 46% amino acid sequence identity to cGHRHR1, suggesting that it is unlikely to originate from a recent gene duplication event that has occurred in avian lineage. In agreement with this notion, a gene orthologous to chicken GHRHR2 was identified in Xenopus and zebrafish genomes (Fig. 1), indicating that GHRHR2 indeed already existed in the last common ancestor of tetrapods and teleosts. In contrast, the GHRHR2 gene could not be identified in the genomes of the mouse, rat, and human, implying that it may have been lost in these mammalian species during evolution.

Interestingly, this novel cGHRHR2 shares comparatively higher amino acid sequence identity to cGHRH-LPR (cPRP-R) (53%) than to cGHRHR1 (46%). A phylogenetic tree constructed using the neighbor-joining method (using MEGA3.1 software) [41] also indicated that cGHRHR2 and cGHRH-LPR were grouped into a monophyletic cluster (Fig. 9), implying that gene duplication, perhaps owing to the whole genome duplication event [42], occurred in the early history of vertebrate evolution and thus resulted in the formation of GHRHR2 and GHRH-LPR. In spite of the close evolutionary relationship between cGHRHR2 and cGHRH-LPR, cGHRH is 400-fold more potent than cGHRH-LP in activating cGHRHR2 (Fig. 4), clearly indicating that cGHRHR2 can function as a novel receptor highly specific to GHRH, but not to GHRH-LP, in chickens (Fig. 10).

View Large Image Download to PowerPoint

Fig. 9. Phylogenetic tree (constructed by the neighbor-joining method) showing the evolutionary relationship of chicken (c) GHRHR1, GHRHR2, GHRH-LPR, PAC1, VPAC1, and VPAC2 with other known related receptors from other species, including the human (h), rat (r), mouse (m), goldfish (gf), zebrafish (zf), rainbow trout (rt), fugu (fu), Rana ridibunda (ra), and Xenopus laevis (x). The number near each branch point indicates the bootstrap value. GHRHR, growth hormone-releasing hormone receptor; GHRHR1, growth hormone-releasing hormone type I receptor; GHRHR2, growth hormone-releasing hormone type II receptor; GHRH-LPR (PRP-R), growth hormone-releasing hormone-like peptide receptor (PACAP-related peptide receptor); PAC1, pituitary adenylate cyclase-activating polypeptide type I receptor; VPAC1, pituitary adenylate cyclase-activating polypeptide type II receptor/vasoactive intestinal polypeptide type I receptor; VPAC2, pituitary adenylate cyclase-activating polypeptide type III receptor/vasoactive intestinal polypeptide type II receptor; PHI-R, peptide histidine-isoleucine receptor; CRHR1, corticotropin releasing-hormone receptor 1.

View Large Image Download to PowerPoint

Fig. 10. (A) Proposed receptor(s) for GHRH or GHRH-related peptides in chickens. Both GHRHR1 and GHRHR2 can function as receptors highly specific to chicken GHRH. GHRH-LP (PRP) has a functional receptor, GHRH-LPR (PRP-R); however, GHRH-LP also activates GHRHR1 with a high potency. Interestingly, both GHRHR2 and GHRH-LPR genes could not be identified in mammalian genomes, implying that both genes may have been lost in mammalian lineage during evolution. PACAP has 3 receptors, PAC1, VPAC1, and VPAC2. Among them, PAC1 is highly specific to PACAP, whereas both VPAC1 and VPAC2 can also function as VIP receptors and potential PHI receptors in chickens. Whether there exists an additional “PHI-specific” receptor (PHI-R) remains questionable. (B) Proposed actions of GHRH and GHRH-related peptides in chicken pituitary (modified from [3]). In this model, GHRH is a potent growth hormone–releasing factor (GRF) [3], [12], [13], [14], [40], and its action is likely mediated by GHRHR1 [28], [29], [30]. VIP has been proven to be a potent prolactin-releasing factor (PRF) in chickens [17], [18], and its action is likely mediated by VPAC1, but not VPAC2. Interestingly, GHRH-LP, PACAP, and PHI can activate either GHRHR1 or VPAC1 with high potencies, implying that they may have the capability to regulate cGH or cPRL secretion through activation of GHRHR1 or VPAC1. In addition, the expression of cGHRHR2, cGHRH-LPR, and cPAC1 in the pituitary suggests the involvement of the 3 receptors in regulating pituitary functions. However, whether they are involved specifically in the regulation of cGH and cPRL secretion remains to be clarified.

The existence of 2 GHRH receptors in chickens consequently raises an interesting issue of whether both receptors have similar roles in pituitary and extrapituitary tissues (Fig. 10). In spite of coexpression of the 2 cGHRH receptors in the pituitary (Fig. 7) [28], [29], [30], several lines of evidence tend to support that cGHRHR1 plays an important role in regulating pituitary GH secretion. First, GHRHR1, instead of GHRHR2, is orthologous to the mammalian GHRHR gene [4]. Second, like mammalian GHRHR, the chicken GHRHR1 gene was shown to be expressed predominantly in the pituitary and was almost absent in other tissues (Fig. 7) [28], [29], [30]. Third, as in mammals [43], the dynamic change of cGHRHR1 expression is correlated temporally with that of cGH expression during embryonic pituitary development, suggesting the involvement of cGHRHR1 in regulating somatotroph proliferation and differentiation [28], [44]. In addition, several putative binding sites of Pit-1, a pituitary-specific transcription factor [45], have been found in the promoter region of the cGHRHR1 gene (1447bp, accession no.: DQ836142) [30], and overexpression of chicken Pit-1 could significantly enhance cGHRHR1 basal promoter activity in cultured chicken DF-1 cells (without endogenous Pit-1 expression) (data not shown), suggesting a role of Pit-1 in regulating cGHRHR1 expression in the pituitary, as reported in mammals [46]. The spatiotemporal expression patterns, together with the common transcriptional regulatory mechanism of the cGHRHR1 gene conserved between mammals and birds [45], [46], suggest that cGHRHR1 plays a substantial role in controlling pituitary GH secretion (Fig. 10). In contrast to cGHRHR1, cGHRHR2 was detected to be abundantly expressed not only in the pituitary, but also in all brain regions examined except the cerebellum (Fig. 7), suggesting it has a physiological role different from that of cGHRHR1. Whether cGHRHR2 is involved specifically in regulating pituitary GH secretion requires further investigation. However, the widely distributed GHRHR2 mRNAs in brain regions, together with detection of cGHRH mRNA expression in the hypothalamus, midbrain, and hindbrain [3], strongly suggest that, in addition to being a hypophysiotrophic factor [3], [13], [14], [40], cGHRH may function as a novel neurotransmitter/neuromodulator in the CNS and its action is likely mediated by the novel cGHRHR2.

4.2. GHRH-LPR (PRP-R) in chickens 

The biological activity of PRP and the identity of a receptor for PRP remain unclear in mammals. However, fish and avian GHRH-LP (PRP) has been shown to be biologically active in terms of its capability in stimulating GH secretion [1], [9], [10], [12]. Consistent with its action in teleosts, GHRH-LPR has been identified in goldfish and zebrafish [22], [25], [47]. In this study, a receptor for GHRH-LP (cGHRH-LPR) was also cloned in chickens, and a functional assay confirmed that it could be activated by GHRH-LP with a potency higher than those of other GHRH-related peptides (Fig. 4), suggesting that cGHRH-LPR can function as a receptor specific to cGHRH-LP (Fig. 10) and mediate the actions of GHRH-LP in chicken tissues. Despite the fact that cGHRH-LP can activate cGHRH-LPR, its potency (EC50: 9.806nM) and efficacy seemed to be much lower (Fig. 4) when compared to that of other GHRH-related peptides in activating their own receptors examined in this study. Whether the lower potency and efficacy simply suggest a less important functional role of cGHRH-LPR and GHRH-LP in chickens, or that cGHRH-LPR would alter its binding affinity and signaling efficacy only in the presence of accessory factors such as receptor activity–modifying proteins (RAMPs), like other GPCR subfamily B-I members [48], requires further investigation. In addition, the possibility that there exist additional GHRH-LPR(s) in chickens, which could bind to cGHRH-LP with high affinity, cannot be ruled out.

In this study, a novel cGHRH-LPR transcript variant (cGHRH-LPR-v1) was identified. Since this transcript variant encodes either a short peptide of 34 a.a. (Fig. 2) or a protein of 279 amino acids without the large N-terminal extracellular domain and first transmembrane domain, both of which are demonstrated to be critical for ligand binding in GPCR subfamily B-I members [2], [20], it seems unlikely that this receptor variant is able to bind GHRH-LP and transmit signals. Thus, the physiological relevance of cGHRH-LPR-v1 in vivo remains to be clarified.

Like the 2 cGHRH receptors, cGHRH-LPR expression could be detected in the pituitary; however, its expression level seems to be low, suggesting that it may have a limited role in the pituitary. In contrast, high expression of cGHRH-LPR was consistently noted in the telencephalon, midbrain, hindbrain, and hypothalamus (Fig. 7). This expression pattern is in accordance with the abundant expression of cGHRH-LP in various brain regions [3], [49]. Similar to our findings in chickens, expression of GHRH-LP and GHRH-LPR was found in the brain of teleost fish [9], [22], [47], [50], strongly supporting a conserved physiological role of GHRH-LP and GHRH-LPR in the brain of nonmammalian vertebrates.

In this study, we could not identify the PRP receptor (GHRH-LPR) gene in genomes of mammalian species including rat, mouse, and human using synteny analysis (data not shown) [3], possibly because of the loss of the PRP receptor gene in mammalian lineage (Fig. 10) [4], [21], [22].

4.3. The potential receptors for PHI in the chicken and other vertebrate species 

It has been suggested that PHI may have a specific high-affinity receptor, which could mediate the unique action of PHI in several mammalian cell lines [51], [52]. However, there is a growing body of evidence that PHI shares many of the biological activities of VIP in a variety of rat tissues [1], and possibly, most of its actions are mediated by VIP receptor(s) [53]. In agreement with this idea, PHI has been shown to be extremely effective in inhibiting the binding of 125I-VIP to its receptors expressed in rat liver and intestinal membranes [53], [54]. Moreover, PHM (an analogue of PHI) or PHV (C-terminal extending form of PHI) could bind to the 2 rat VIP receptors (VPAC1 and VPAC2) expressed in CHO cells or COP cells, with an affinity only 1- to 3-fold lower than VIP and PACAP27 [55], [56]. In addition, PHM could increase the intracellular cAMP levels in cells expressing VPAC1 with an EC50 (1.0nM) close to that of VIP (0.57nM) [55], [57]. All of this evidence tends to support that VIP receptor(s) may function as potential receptor(s) for PHI in rats.

Similar to those findings in rats [55], turkey PHI could dose-dependently stimulate luciferase activity of CHO cells via activation of cVPAC1 or cVPAC2, with a potency only 1.5- to 4-fold lower than that of VIP or PACAP38 (Fig. 4), suggesting that both VIP receptors may function as potential PHI receptors in chickens (Fig. 10). Interestingly, in chickens, the unlabeled PACAP, VIP, and PHI have been shown to be equally potent in displacing 125I-PHI binding in liver membranes [58]. In the same study, the GppNHp-insensitive 125I-VIP binding sites on liver membranes also display high affinity for PHI, indicating that a GTP-insensitive VIP receptor may correspond to a high-affinity PHI receptor (GppNHp is a non-hydrolyzable analog of GTP) [52], [58]. These findings also partially coincide with the expression of VIP receptors in chicken liver (Fig. 8) and the pharmacological profiles of cVPAC1 and cVPAC2 examined in this study (Fig. 4).

It has been reported that a receptor specific to PHI has been identified in goldfish and zebrafish [22], [26]. In addition, a functional study revealed that PHI, but neither VIP nor PACAP, could potently stimulate the intracellular cAMP levels of CHO or COS7 cells expressing fish PHI receptor (PHI-R) [22], [26]. However, both synteny analysis and phylogenetic analysis clearly indicated that zebrafish PHI-R is an ortholog of the VPAC2 gene from other vertebrate species, including the chicken, Xenopus, and human (Fig. 9) [21], [22]. These findings, together with the high potency of PHI on activation of VPAC2 from the rat, human, and chicken (Fig. 4) [22], strongly support that the VPAC2 gene may act as a receptor for PHI in vertebrates. Despite the dramatic functional change of the VPAC2 gene during evolution (or speciation), the high affinity for PHI may represent one of the ancestral pharmacological properties of VPAC2, which has been well preserved in some species from different vertebrate groups, including fish, birds, and mammals [22], [26]. Clearly, further studies on the pharmacological profile of VPAC2 from a greater number of vertebrate species would be required to confirm whether the VPAC2 gene can function as a potential PHI receptor in vertebrates [22].

4.4. Differential roles of VPAC1 and VPAC2 in chicken pituitary 

It is well known that VIP plays a wide range of roles in various tissues of vertebrates [1]. As expected, the expressions of both VIP receptors (cVPAC1 and cVPAC2) were detected in most of the chicken tissues examined in this study (Fig. 7, Fig. 8), suggesting the involvement of both receptors in mediating VIP actions in these tissues. Interestingly, differential expression of the 2 VIP receptors was apparent in the pituitary, in which predominantly cVPAC1, instead of cVPAC2, was detected to be expressed (Fig. 7, Fig. 8). This finding is consistent with previous findings in turkeys and chickens, in which VPAC1 was demonstrated to be abundantly expressed in the pituitary using in situ hybridization or Northern blot analysis [31], [32], [59]. The predominant expression of cVPAC1 in the pituitary clearly points out that the PRL-releasing action of VIP in chickens is mediated by cVPAC1, but not cVPAC2 (Fig. 10).

4.5. Cross-reactivity between GHRH-related peptides and their receptors and its implications on the capability of GHRH-related peptide in regulating pituitary GH and PRL secretion 

Given the high degree of structural similarity shared between different GHRH-related peptides and between their corresponding receptors, it is not surprising that they exhibit varying degrees of cross-reactivity [1], [2]. In this study, we also noted that each receptor could be activated by several GHRH-related peptides (Fig. 4). The activation of a receptor by multiple peptides, particularly at physiologically relevant concentrations, allows us to speculate that these peptides may regulate the same physiological event via activation of a common receptor. For instance, both cVIP and PHI can activate cVPAC1, but PHI is slightly less potent than VIP (Fig. 4). This finding accounts well for the less potent action of PHI than that of VIP in stimulating PRL secretion in cultured turkey pituitary cells [16], and most likely, both peptides may exert their PRL-releasing actions through VPAC1 (Fig. 10), which was shown to be abundantly expressed in the pituitary (Fig. 7) [31], [32], [59]. Similarly, both oPACAP and cGHRH can activate cGHRHR1; however, oPACAP (EC50: 5.61nM) is 100-fold less potent than cGHRH (EC50: 0.053nM) (Fig. 4). This finding also provides a possible explanation of the weak GH-releasing effect of PACAP in cultured chicken pituitary somatotroph—an effect that might be partially mediated by cGHRHR1 (Fig. 10) [60]. As in mammals [1], [5], PACAP can activate VPAC1 with the same potency as VIP in chickens (Fig. 6). This finding, together with the abundant expression of VPAC1 in the pituitary (Fig. 9), points out the possibility that hypothalamic PACAP may be involved in regulation of cPRL secretion via cVPAC1 activation (Fig. 10), although at present, this idea still lacks support from experimental evidence. Clearly, our study on the specificity and relative potency of each peptide in activating its own receptor and structurally related receptors, together with more precise localization of each receptor in chicken tissues, would help to not only elucidate the physiological roles of GHRH and GHRH-related peptides in target tissues including the pituitary (Fig. 10), but also to clarify whether their actions are mediated by their own specific receptor(s) or by cross-binding to other common receptor(s) (Fig. 10).

In summary, we have developed a novel concept that 2 GHRH receptors (GHRHR1 and GHRHR2) are expressed and functional in chickens, and possibly in the frog and in fish. Furthermore, the functional receptors for cGHRH-LP (cPRP), cVIP, and cPACAP were identified, and 2 potential receptors (cVPAC1 and cVPAC2) for cPHI were suggested (Fig. 10). These findings, together with the study of spatial expressions of the 6 receptors in chickens, not only help to elucidate the physiological roles of GHRH and GHRH-related peptides in target tissues, including their actions in the pituitary (Fig. 10), but also provide important understanding of the structural and functional changes of these hormone/ligand receptor pairs in the course of vertebrate evolution (Fig. 10).